Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Case Report
Case Series
Editorial
EDITORIAL BOARD
Editorial I
Editorial II
Original Article
Review
Review Article
Systematic Review
Generic selectors
Exact matches only
Search in title
Search in content
Post Type Selectors
Search in posts
Search in pages
Filter by Categories
Case Report
Case Series
Editorial
EDITORIAL BOARD
Editorial I
Editorial II
Original Article
Review
Review Article
Systematic Review
View/Download PDF

Translate this page into:

Original Article
20 (
1
); 10-22
doi:
10.25259/IJHS_50_2025

Clinical effectiveness of droplet digital polymerase chain reaction technology for human epidermal growth factor receptor 2/neu gene testing in breast cancer compared to conventional methods

Department of Biochemistry, King Abdulaziz University, Jeddah, Saudi Arabia.
Department of Bioinformatics and Artificial Intelligence, Institute of Genomic Medicine Sciences, King Abdulaziz University, Jeddah, Saudi Arabia.

*Corresponding author: Mourad Assidi, Department of Bioinformatics and Artificial Intelligence, Institute of Genomic Medicine Sciences, King Abdulaziz University, Jeddah, Saudi Arabia. mourad.assidi@gmail.com

Licence
This is an open-access article distributed under the terms of the Creative Commons Attribution-Non Commercial-Share Alike 4.0 License, which allows others to remix, transform, and build upon the work non-commercially, as long as the author is credited and the new creations are licensed under the identical terms.

How to cite this article: Al-Zahrani MH, Jafri MA, Buhmeida A, Assidi M. Clinical effectiveness of droplet digital polymerase chain reaction technology for human epidermal growth factor receptor 2/neu gene testing in breast cancer compared to conventional methods. Int J Health Sci (Qassim). 2026;20:10-22. doi: 10.25259/IJHS_50_2025

Abstract

Objectives:

Breast cancer (BC) is the most common cancer in women worldwide and has poor survival outcomes. The human epidermal growth factor receptor 2 (HER2), a key promoter of tumor progression and metastasis, is overexpressed or amplified in 15–20% of BC cases, leading to worse prognosis. The introduction of anti-HER2 monoclonal antibodies has significantly improved survival in advanced HER2-positive BC. Current HER2 testing in routine diagnostic practice relies on immunohistochemistry (IHC) and in situ hybridizations (ISH) techniques as US Food and Drug Administration-approved methods. However, these standard methods still have some limitations related to subjectivity, reproducibility, accuracy, and cost. To overcome these challenges, this study investigated droplet-based digital polymerase chain reaction (ddPCR) as a breakthrough technology for absolute DNA quantification.

Methods:

The ddPCR is a reliable third-generation PCR-based technology that has higher sensitivity, accuracy, and reproducibility. The HER2 gene status testing was assessed using ddPCR in a retrospective cohort of 36 formalin-fixed and paraffin-embedded tissues from BC patients with invasive ductal carcinoma.

Results:

Our results showed that ddPCR has very high concordance rates of 81% and 83% with IHC and brightfield double ISH (BDISH), respectively.

Conclusion:

These findings highlight the high accuracy and concordance of ddPCR with both BDISH and IHC, emphasizing its potential usefulness for HER2 testing in BC. After further optimization and standardization in larger cohorts, ddPCR hold the promise to become a rapid, reliable, and cost-effective alternative method suitable for the accurate assessment of HER2 gene status and other amplification-based genes for oncotherapies.

Keywords

Brightfield double in situ hybridization
Droplet-based digital polymerase chain reaction
Human epidermal growth factor receptor 2 expression
Human epidermal growth factor receptor 2 testing
Human epidermal growth factor receptor 2/neu gene amplification
Immunohistochemistry

INTRODUCTION

Breast cancer (BC) is a heterogeneous disease caused by cumulative, independent mutations (in oncogenes and/or tumor suppressor genes) and considerable genetic instability, leading to cell transformation, uncontrolled cell proliferation, and migration of cancer cells to distant regions of the body.[1-3] In addition, BC remains the most common malignancy in women worldwide with an estimated incidence of 2.3 million new cases/year and 685,000 deaths in 2020.[4] In the United States, there is an average lifetime risk of 12.3% that a woman will be diagnosed with BC during her lifetime.[5] Despite the decline in BC-related deaths in USA, it is still the second leading cause of cancer death in women.[6] Mortality rates vary widely from country to country; the highest age-standardized mortality rate was recorded in Fiji (41.0/100,000 population), and the lowest in South Korea (6.4/100,000 population).[4] The BC is also the most commonly diagnosed cancer in the Kingdom of Saudi Arabia and the second-leading cause of death after leukemia in 2018.[7] Based on GLOBOCAN data for 2020, age-standardized rates for the incidence and mortality of BC in Saudi women were 28.8% and 8.4%, respectively.[8] Unfortunately, these rates are rising annually.[9] Specifically, between 2004 and 2016, Saudi Arabia’s incidence of BC rose by 186%.[10] The ongoing rise of BC cases, particularly in Saudi Arabia, is believed to be caused by several reasons including aging populations, delayed diagnosis, lack of knowledge, and unhealthy lifestyle choices, including smoking, poor eating habits, and physical inactivity.[11-13]

Surgery has been the main treatment strategy for BC patients up to this point. To guarantee disease eradication and avoid recurrence, other modalities such chemotherapy, radiation, hormone therapy, and/or immunotherapy/targeted therapy are also used.[8] Unfortunately, despite the invasive nature of most of these therapeutic measures, they have failed to effectively cure the disease and prevent relapse; worse still, some of them can cause serious side effects and/or drug resistance.[14,15] Besides the clinic-pathological features, several commendable studies have been conducted to identify potential molecular biomarkers for better prognosis, management, and treatment of BC patients.

For instance, the exact genetic grading of BC into many subtypes to find more suitable or accurate treatment choices has been made possible in large part by the application of multi-omics techniques.[16-18] In addition to estrogen receptor[19] and progesterone receptor,[20] recent advances in clinical trials, especially in cancer immunotherapies, promising treatment options for various cancer types, including BC (e.g., anti-PDL1 approved by the U.S. Food and Drug Administration (FDA) in 2019 for triple-negative metastatic BC.[21,22] In this context, human epidermal growth factor receptor 2 (HER-2), a transmembrane tyrosine kinase receptor of the epidermal growth factor receptor family, which is present on the membrane of cancer cells and encoded by the HER2/neu gene, is the most important molecular target with prognostic and therapeutic value.[23,24] HER2 is overexpressed in approximately 15–20% of breast tumors, and this overexpression is associated with poor prognosis and shortened patient survival.[25] HER2 gene amplification has been shown to correlate with HER2 overexpression protein in a number of solid tumor types, including breast, gastric, ovarian, and bladder tumors.[26] HER2-positive (HER2+) status is associated with disease onset and progression and is associated with poor a prognosis, including aggressive disease and shorter survival.[27,28] A targeted therapy, trastuzumab (Herceptin), has been developed and successfully incorporated into the treatment regimen for various cancers such as BC. This clearly shows that an accurate HER2 test is essential for the selection of patients eligible for Herceptin therapy and thereby benefits the most from this form of treatment. Nowadays, immunohistochemistry (IHC) and/ or fluorescence in situ hybridization (FISH) techniques, which have been authorized by the US FDA, are used in regular diagnostic practice to identify the presence of HER2 amplification.[29] In addition, the American Society of Clinical Oncology/College of American Pathology (ASCO/CAP) has published guidelines for HER2 testing guidelines that provide valuable recommendations to ensure accurate assessment of HER2 status in BC patients through rigorous standardization of IHC and in situ hybridization (ISH) techniques worldwide. The FISH assay determines the precise number of copies of the HER2 gene per nucleus and the ratio between the HER2 gene and a control probe to ascertain the HER2 amplification status, whereas the HER2 IHC test uses the intensity of the color reaction to indirectly detect the overexpression of HER2 protein on the surface of BC cells.[30] Although both methods have high specificity and reproducibility when performed with a standardized and validated testing protocol, they still have some limitations related to lengthy protocols, subjectivity, reproducibility, accuracy, and/or cost. While IHC testing is simple and preferred by most domestic pathology laboratories, the sensitivity and specificity of IHC testing can be compromised by potential damage to HER2 cell surface protein during processing (fixation and staining) of formalin-fixed and paraffin-embedded (FFPE) tissue. This affects the quality of the staining and consequently leads to subjective IHC results.[31] On the other hand, the FISH procedure is laborious, time-consuming, requires expensive fluorescence probes, and the fluorescent signal cannot be stored for long periods of time, which limits its application.[32] Efforts have been made to develop quantitative measurements and/or automated protocols that are expected to be more accurate and reproducible when analyzed statistically. Besides the efforts in the field of quantitative histopathology[33] and the refinement of FISH techniques (using chromogenic, silver, or brightfield methods),[34-36] discordance between the two techniques remains a well-recognized problem in HER2 testing.[37] Therefore, this study was designed to investigate the feasibility of droplet-based digital polymerase chain reaction (ddPCR) as a new technique/assay for high-precision analysis of genomic copy number variation (CNV) of HER2 gene status. Its high accuracy, sensitivity, reproducibility, and absolute quantification capability make it a powerful tool for HER2 gene detection.[38] This portable technology can not only replace FISH detection in tissues but also has higher sensitivity, accuracy, and reproducibility making it suitable for the increasing demand in point-of-care diagnostics, as well as for small samples and liquid biopsies in cancer research.[39,40] It can also be useful for the detection of nucleic acids in body fluids such as cell-free DNA.[41]

The aim of this study was to investigate the usefulness of ddPCR technology HER2 amplification to assess HER2 gene amplification status in Saudi BC patients. To this end, ddPCR results will be compared with IHC and brightfield double ISH (BDISH) results performed on the same samples to determine whether this technology could provide a more accurate, non-invasive, and cost-effective method to assess HER2 status in BC and subsequently in all solid tumors. This approach should enable better identification of cancer patients eligible for trastuzumab therapy, which could improve the care of cancer patients in the future toward precision oncology.

MATERIALS & METHODS

Study design

This retrospective cohort consisted of FFPE tissue from 36 patients with primary invasive ductal breast carcinoma and ages ranging from 15 to 92 years with a mean ± standard error of 56.5 ± 13.3. All patients were diagnosed and treated mainly in the Departments of Surgery and Oncology at King Abdulaziz University Hospital between 2000 and 2008. Resistant or recurrent BC patients were excluded from this study. The clinicopathological data were carefully compiled from the patients’ medical records. The experiments were conducted at the Center of Excellence in Genomic Medicine Research. Written informed consent was obtained from all patients, and the Ethical Committee of the Faculty of Medicine, KAU, approved all experiments of the study (Ethical Approval Number: 146-25). The inclusion criteria for the samples used for IHC, BDISH, and ddPCR were based on the availability of FFPE blocks converted to tissue microarray (TMA), their clinicopathological data, and their corresponding DNA. Samples were fixed in 4% neutral-buffered formalin for 6–48 h at room temperature and then processed according to the established standard protocols. For quality control, standard slides for HER2 Dual ISH 3-in-1 xenograft of BC (Roche Diagnostics GmbH, Mannheim, Germany) representing HER2 gene/protein status in the three different scoring levels (amplified (+3), equivocal (+2), and non-amplified (0, +1)) were used as control samples for both IHC and BDISH experiments and therefore stained together with the patients’ samples in the same BC staining run.

IHC using TMA slides

HER2 protein expression was analyzed by IHC assay using TMA slides. The HER2 IHC assay was performed using the iView 3,3′-Diaminobenzidine (DAB) Detection Kit (Ventana) on a BenchMark XT automated staining system (Ventana, USA) and the rabbit monoclonal antibody Pathway Anti-HER2 (clone 4B5; Ventana, USA) as previously described.[42] In brief, a fully automated protocol was developed so that the entire assay procedure starting from deparaffinization with EZ Prep (Ventana) at 75°C to incubation with the anti-HER2 primary antibody for 16 min at 37°C was fully automated. The slides were counterstained with Hematoxylin II (Ventana) for 4 min and Bluing Reagent (Ventana, USA) for 4 min. After completion of the staining process and removal from the stainer, the slides were rinsed with buffer residues and/or liquid coverslip solution with a mild detergent and then subjected to 3-min with water and immersed in alcohol buffer of increasing concentration (70%, 95%, and 100%) for 3 min in succession. A drop of Tissue-Tek glass mounting medium was then applied to each slide and covered with glass coverslip.

BDISH

The BenchMark® XT Automated Slide Processing System (Ventana, USA) was used to perform the BDISH test in a single step on FFPE BC specimens to detect HER2 and CEN 17 DNA targets. After 20 min of baking at 65°C, FFPE slides were deparaffinized using EZ PrepTM (Ventana, USA) for 16 min at 75°C. Deparaffinized slides were pretreated with heat treatment buffer (Tris-based pH 7.6 solution, Ventana, USA) and then treated with either ISH protease 3 or protease 2 to reveal DNA targets. To identify the HER2 gene, the INFORM® HER2 DNA probe (Ventana, USA), a dinitrophenyl (DNP)-labeled, nick-translated repeat deleted DNA probe, was co-denaturated and targeted at 95°C. After that, the hybridization procedure was run for 2 h at 52°C. Following three thorough washings at 72°C with two SCC, the tissue sections were subjected to 20 min of monoclonal rabbit anti-DNP antibody treatment (Ventana) and 16 min of HRP-conjugated anti-rabbit antibody treatment (Ventana) at 37°C. Silver acetate, hydroquinone, and H2O2 reacted with the ultra ViewTM SISH to produce the metallic silver coating for the HER2 ISH signal. Following three thorough washings with two SSC at 59°C, tissues were subjected to 20 min of treatment with a rabbit monoclonal anti-DNP antibody and 12 min of treatment with an anti-rabbit antibody conjugated to alkaline phosphatase at 37°C. The ultraView Red ISH Detection Kit and the rapid red and naphthol phosphate reaction were ultimately used to find the signal for CEN 17. A ready-to-use tetramethylbenzidine solution from Fitzgerald Industries International, Concord, Massachusetts, as well as the Ventana ultraView Universal DAB Detection Kit, 5-bromo-4-chloro-3-indolyl phosphate substrate, and nitro blue tetrazolium oxidizer of the ISH iVIEWTM blue detection kit were also tested. To make sure the anti-DNP antibody used for CEN 17 detection would not detect the DNP hapten of the HER2 probe, CEN 17 signal detection was carried out after HER2 signal detection without the DNP-labeled CEN 17 probe. After the run, the stained slides containing the buffer residues and liquid coverslip solution were rinsed with a moderate detergent before being air-dried at 45°C for 15 min. The slides were then temporarily immersed in a xylene bath before being covered with a Tissue-Tek Film Cover Slipper.

Scoring system for HER2 gene/protein amplification/ expression status

According to the most recent ASCO/CAP scoring system (ASCO/CAP guidelines[43]), the scoring method for HER2 cell membrane protein expression is based on the staining pattern of the cell membrane. The results of HER2 tests using IHC are divided into three categories: Positive, equivocal, and negative. The BDISH test was used to confirm the amplification status of the HER2 gene in cancer samples with an ambiguous IHC result. In the HER2 BDISH assay, the test (HER2/Chr17 ratio) and subsequent evaluation were performed according to the guidelines for scoring systems (ASCO/CAP). However, it should be emphasized that according to the ASCO/CAP guidelines for the ISH technique, if the result is equivocal (HER2/CEP17 ratio is 1.8–2.2), an additional 20 cells must be counted for both HER2 and CEP17 and the ratio calculated once again. If the new ratio is below <2, then HER2 is considered as non-amplified; but when it is above >2, HER2 is amplified.

Droplet digital PCR procedure

DNA isolation and quality assessment

DNA isolation from FFPE samples was performed using the QIAamp DNA FFPE Tissue Kit (Qiagen) according to the company’s instructions and guidelines. The isolated DNA samples were subjected to quality control to assess the concentration and purity using the NanoDrop 2000c spectrophotometer (Thermo Fisher Scientific, Inc.) before starting the actual ddPCR experiment.

Quantification of the HER2 gene copy number by ddPCR

Droplet digital PCR to determine the copy number of the HER2 gene was performed using the QuantStudio® 3D digital PCR system (Applied Biosystems) according to the manufacturer’s protocol. A ready-made TaqMan® copy number assay for (HER2 gene) (Cat. No. 4400291, Assay ID Hs02803918_cn, EntrezGeneID2064) and a TaqMan® RNaseP copy number reference assay (Cat. No. 4403326) (Thermo Fisher) were validated to ensure specificity and efficiency using suitable primers [Table 1].

Table 1: Primer and probe sequences used in the study.
Primer/probe name Sequence Storage
HER2 forward (5′ACAACCAAGTGAGGCAGGTC3′) −20°C
HER2 reverse (5′GTATTGTTCAGCGGGTCTCC3′)
MGB probe (FAM) for HER2 (5′FAMCCCAGCTCTTTGAGGACAACMGB3′)
EFTUD2 forward (5′GGTCTTGCCAGACACCAAAG3′)
EFTUD2 reverse (5′TGAGAGGACACACGCAAAAC3′)
MGB probe (VIC) for EFTUD2 (5′VICGGACATCCTTTGGCTTTTGAMGB3′).

MGB: Minor groove binder, HER2: Human epidermal growth factor receptor 2, FAM: Fluorescein amidite, EFTUD2: Elongation factor Tu GTP binding domain containing 2

Equal amounts of DNA were then amplified using the GeneAmp PCR System 9700 including a chip adapter kit and an automated chip loader and read on the QuantStudio® 3D Digital PCR System.

The setup of the digital PCR reaction includes the preparation of a master mix containing PCR reagents, primers, probes, and DNA template, following the manufacturer’s recommendations. The concentration of the input DNA was refined by appropriate dilutions to 10 ng/μL to obtain a copy number of the target sites in the range of 200–2000 copies/μL. The QuantStudio 3D Digital PCR kit tubes were gently shaken at low speed and a master mix was prepared based on a final 15 μL per each TaqMan PCR reaction as follows: 15 μL reaction mix was prepared, consisting of 7.5 μL QuantStudio 3D Digital PCR Master Mix (×2), 0.75μL TaqMan® Copy Number Assay (×20) for the target gene, 0.75 μL of TaqMan® Copy Number Reference Assay for a single-copy reference gene (×20), and 10 ng template DNA.

The volume of the total master mix is then adjusted to the final number of reactions with nuclease-free water based on a volume of 15μL/reaction.

The PCR reactions were loaded onto the QuantStudio 3D Digital PCR Chip v2, and the loaded chip was carefully loaded into the QuantStudio® 3D Digital PCR System. Positive and negative templates were also used as controls. Thermal cycling is then initiated according to the established PCR cycling conditions for the QuantStudio® 3D Digital PCR System as follows: 10 min of initial denaturation at 96°C, followed by 40 three-step cycles of ((i) denaturation for 30 s at 98°C; (ii) annealing at 60°C for 2 min; and (iii) extension at 60°C for 2 min), and then a final inactivation step for 10 min at 98°C before holding at 4°C. After the digital PCR run, the chips were read using QuantStudio® 3D Digital PCR Analysis Suite Software for data analysis to obtain absolute quantification of the copy number of the target and reference genes in each well.

HER2 copy number analysis by ddPCR

The principle of the ddPCR method is based on the fractionation of a sample for many miniature reactions. Copy number analysis was performed using QuantStudio 3D Analysis Suite Software. In fact, the chips were pictured on the QuantStudio3D instrument, which performs the information analysis and evaluates the concentration of the nucleic acid sequence of HER2 and the reference gene targeted by the probes labeled with FAM and VIC dye, respectively. To assess CNV, the ratio of the HER2 gene to the reference gene was calculated, normalized to the reference sample (with a known diploid copy number), and then converted to copies/μl as described by Dong et al.[44] The FAM/VIC ratio was calculated and only ratios >1.8 were considered as amplified (positive), as shown in previous reports.[45,46] The ratio of HER2 to RNase P indicates the number of copies of HER2 per haploid genome that are converted to a diploid genome.

Statistical analysis

The software packages Statistical Package for the Social Sciences (IMB NY, USA) (PASW Statistics for Windows, Version 22) were used to perform the statistical analysis for both the IHC and BDISH studies. Frequency tables were analyzed using the Chi-square test, and the significance of the correlation between the categorical variables was assessed using likelihood ratio test or the exact Fischer test. The univariate survival analysis for the outcomes: Disease-specific survival and disease-free survival was based on the Kaplan–Meier method with the log-rank comparison test (Mantel-Cox). The sensitivity and specificity of all three methods (techniques) were also assessed and defined as follows: Sensitivity shows how well a test can identify people who have the disease (true positives among all actual positives), whereas specificity reflects the test’s ability to accurately identify those without the disease (true negatives among all actual negatives). For all tests, values P < 0.05 were considered statistically significant.

Ethical approval

This study was approved by the Ethics Committee of the Faculty of Medicine, KAU, (Date: April 10, 2025), No: 146-25.

RESULTS

Patients and samples

In this study, we enrolled 36 Saudi women diagnosed with BC who provided informed consent and were under follow-up at the Oncology Department of King Abdulaziz University Hospital. These patients underwent various treatment protocols, including hormonal therapy, chemotherapy, and radiotherapy, either individually or in combination, as part of their standard care. The age distribution of the participants ranged from 23 to 84 years, reflecting a diverse patient population in terms of disease presentation and treatment response. This study aims to provide valuable insights into the clinical utility of ddPCR in refining HER2+ targeted therapy outcomes of BC patients. In fact, the accurate determination of HER2 status is crucial for identifying patients who qualify for HER2-targeted treatments like trastuzumab, which are proven to significantly enhance survival rates in BC patients. Furthermore, and by demonstrating the high concordance of ddPCR with IHC and BDISH, this study underscores the ddPCR potential to reduce patients’ misclassification to ensure that only HER2+ patients are correctly chosen for targeted therapy, while HER2-negative patients will avoid unnecessary treatment and related toxicities. Importantly, ddPCR proved especially useful in clarifying equivocal or borderline cases, a known limitation of traditional HER2 testing methods. Its ability to provide more accurate patient stratification directly leads to better therapeutic outcomes and supports our suggestion to incorporate ddPCR into clinical workflows as a complementary or alternative diagnostic tool in precision oncology.

Evaluation of HER2 protein expression and HER2/neu gene status amplification

In this study, 36 samples were analyzed for HER2 protein expression and gene amplification using IHC and BDISH assays. IHC results showed that 16 samples (44%) were HER2+ (3+), while 20 (56%) were negative (0, 1+). BDISH detected HER2 gene amplification in 7 samples (19%), with 29 (81%) classified as negative. These findings reveal a discrepancy between HER2 protein expression and gene amplification, underscoring the need for both IHC and BDISH for accurate assessment. This distinction is crucial for guiding targeted therapy, ensuring HER2+ patients receive appropriate treatment, while HER2-negative cases explore alternative options [Figure 1].

Validation and concordance of human epidermal growth factor receptor 2 (HER2) protein expression and HER2/neu gene amplification status by Immunohistochemistry (IHC) (a and c) and brightfield dual in situ hybridization (BDISH) (b and d) in breast cancer tissue microarray samples. (a): Negative HER2 protein expression (0) and its corresponding, (b) non-amplified HER2/neu gene as detected by BDISH, (c) high HER2 protein expression (3+) and its corresponding, and (d) amplified HER2/neu gene. Magnification: ×40.
Figure 1:
Validation and concordance of human epidermal growth factor receptor 2 (HER2) protein expression and HER2/neu gene amplification status by Immunohistochemistry (IHC) (a and c) and brightfield dual in situ hybridization (BDISH) (b and d) in breast cancer tissue microarray samples. (a): Negative HER2 protein expression (0) and its corresponding, (b) non-amplified HER2/neu gene as detected by BDISH, (c) high HER2 protein expression (3+) and its corresponding, and (d) amplified HER2/neu gene. Magnification: ×40.

Analysis of HER2 gene amplification using ddPCR

HER2 copy number detection was conducted using the ddPCR assay and analyzed with QuantStudio 3D software for precise quantification. The ddPCR assay determined HER2 amplification status as either positive or negative based on fluorescence signals from FAM/VIC staining. This approach provides a highly sensitive and accurate method for assessing gene amplification, offering valuable insights into HER2 status.

The detailed results of all 36 samples are presented in Tables 25. According to the ddPCR analysis, HER2 gene amplification was detected in 13 samples (36%), indicating a higher gene copy number in these cases. In contrast, 23 samples (64%) were classified as non-amplified, suggesting the absence of significant HER2 gene alterations. These findings provide a quantitative assessment of HER2 status, which is essential for accurately identifying patients who may benefit from HER2-targeted therapies. The distribution of amplification status further emphasizes the variability in HER2 expression among BC patients, highlighting the importance of precise molecular testing for personalized treatment strategies.

Table 2: Descriptive evaluation of concordance, sensitivity, and specificity rates of HER2/neu status assessment in FFPE samples using ddPCR in contrast to IHC.
HER2 status using ddPCR IHC Concordance rate (%) Sensitivity (%) Specificity (%) Total (%)
Positive Negative
13 positive 11 (TP) 2 (FP) 11/13 (85) 11/16 (69) 18/20 (90) 13 (36)
23 negative 5 (FN) 18 (TN) 18/23 (78) 23 (64)
Total (%) 16 (44) 20 (56) - - - 36 (100)

ddPCR: Droplet digital polymerase chain reaction, IHC: Immunohistochemistry, HER2: Human epidermal growth factor receptor, FFPE: Formalin-fixed and paraffin-embedded, TP: True positive, TN: True negative, FP: False positive, FN: False negative. Where sensitivity (positivity) is calculated as TP/(TP+FN), and specificity (negativity) as TN/(TN+FP)

Table 3: Summary of the concordance, sensitivity, and specificity rates between the 3 HER2/neu status evaluation techniques ddPCR, IHC, and BDISH.
ddPCR versus IHC (%) ddPCR versus BDISH (%) IHC versus BDISH (%)
Concordance in positive detection (%) 85 54 44
Concordance in negative detection (%) 78 100 100
Overall concordance (%) 82 77 72
Sensitivity (%) 69 100 100
Specificity (%) 90 79 69

ddPCR: Droplet digital polymerase chain reaction, IHC: Immunohistochemistry, HER2: Human epidermal growth factor receptor, BDISH: Brightfield double in situ hybridization

Table 4: Evaluation of concordance, sensitivity, and specificity rates of HER2/neu status assessment in FFPE samples using ddPCR in contrast to BDISH.
HER2 status using dPCR BDISH Concordance rate (%) Sensitivity (%) Specificity (%) Total (%)
Positive Negative
13 Positive 7 (TP) 6 (FP) 7/13 (54) 7/7 (100) 23/29 (79) 13 (36)
23 Negative 0 (FN) 23 (TN) 23/23 (100) 23 (64)
Total (%) 7 (19) 29 (81) - - - 36 (100)

ddPCR: Droplet digital Polymerase chain reaction, BDISH: Brightfield double in situ hybridization, HER2: Human epidermal growth factor receptor 2, FFPE: Formalin-fixed and paraffin-embedded, TP: True positive, TN: True negative, FP: False positive, FN: False negative. Where sensitivity (positivity) is calculated as TP/(TP+FN), and specificity (negativity) as TN/(TN+FP)

Table 5: Comparison between the 3 HER2/neu status evaluation techniques IHC, BDISH, and ddPCR in terms of cost, duration, and the simplicity of the procedure.
ddPCR IHC BDISH
Target biomolecule DNA Protein DNA
Cost + ++ +++
Time consuming + ++ +++
Procedure Simple Laborious Medium
Benchtop device option Yes - -

ddPCR: Droplet digital polymerase chain reaction, BDISH: Brightfield double in situ hybridization, HER2: Human epidermal growth factor receptor 2, IHC: Immunohistochemistry

Associations between HER2 status assessment using ddPCR data and IHC results

The results in Table 2 indicate that ddPCR detected HER2 gene amplification in 13 samples (36%), while 23 samples (64%) showed no evidence of amplification. In contrast, IHC analysis revealed HER2 protein overexpression in 16 samples (44%), whereas 20 samples (56%) were classified as negative. A comparison between ddPCR and IHC for HER2 status detection demonstrated a strong concordance rate of 81%.

Furthermore, when assessing the performance of ddPCR relative to IHC, the assay exhibited a sensitivity of 69%, highlighting its effectiveness in accurately identifying true positive cases. The specificity was notably high at 90%, demonstrating its precision in correctly identifying true negative cases [Table 3].

Associations between HER2 status assessment using ddPCR data and BDIHS results

Similar to IHC, ddPCR demonstrated a high concordance rate of 83% with BDISH, indicating a strong correlation between their results [Table 4]. Both assays exhibited reliable performance, with ddPCR achieving a sensitivity of 100% and a specificity of 79%. Notably, ddPCR stands out as a more accurate and cost-effective alternative to BDISH, making it a practical choice in both technical efficiency and economic feasibility [Table 5].

Associations between HER2 status assessment using IHC and BDIHS results

The evaluation of IHC and BDISH assays in our cohort demonstrated a concordance rate of 75%, indicating a strong agreement between the two methods. Both assays exhibited high reliability, with sensitivity reaching 100% and specificity at 69% [Table 6]. These results validate IHC and BDISH as established standard techniques for HER2 testing, ensuring consistency in clinical applications. Overall, these findings highlight ddPCR as a dependable method for determining HER2 status, emphasizing its potential advantages in specific clinical and research settings.

Table 6: Evaluation of concordance, sensitivity, and specificity rates of HER2/neu status assessment in FFPE samples using IHC in contrast to BDISH.
HER2 status using IHC BDISH Concordance rate (%) Sensitivity (%) Specificity (%) Total (%)
Positive Negative
16 Positive 7 (TP) 9 (FP) 7/16 (44) 7/7 (100) 20/29 (69) 16 (44)
20 Negative 0 (FN) 20 (TN) 20/20 (100) 20 (56)
Total (%) 7 (19) 29 (81) - - - 36 (100)

IHC: Immunohistochemistry, BDISH: Brightfield double in situ hybridization, HER2: Human epidermal growth factor receptor, FFPE: Formalin-fixed and paraffin-embedded, TP: True positive, TN: True negative, FP: False positive, FN: False negative. Where sensitivity (positivity) is calculated as TP/(TP+FN), and specificity (negativity) as TN/(TN+FP)

DISCUSSION

The advent of targeted cancer therapies necessitates accurate categorization and classification of cancer patients who overexpress certain targets. This stratification is essential to ensure that these patients receive appropriate therapies and achieve optimal results. The HER2 is a receptor found on the cell membrane, encoded by the HER2/neu gene located on chromosome 17q21.[47,48] The receptor contains multiple structural domains and can exist in either homodimerized or heterodimerized forms.[49] Importantly, HER2 plays a crucial role in every stage of cell development. The amplification or overexpression of HER2 results in excess HER2 signaling, which impacts cell proliferation, DNA synthesis, and tumorigenesis. HER2 is central to precision oncology, with approximately 20% of BC cases exhibiting HER2 overexpression and/or amplification of the ERBB2 gene or HER2.[50] This amplification is linked to a more aggressive form of metastatic disease and serves as an indicator of poor prognosis. Therefore, accurately selecting HER2+ BC patients is critical for effectively treating them with the currently available anti-HER2 drugs. This selection should involve the most suitable molecular tests to evaluate HER2 protein overexpression and HER2 gene amplification. The FISH test determines the exact number of HER2 gene copies per nucleus and the ratio between the HER2 gene and a control probe to establish HER2 amplification status, while the HER2 IHC test assesses the intensity of the color reaction to identify HER2 protein overexpression on the surface of BC cells.[30] The techniques currently recommended by ASCO/CAP for determining HER2 status in patients with gastric and BC, as well as more recently in advanced gastroesophageal junction cancer, are IHC and FISH.[43,50-53] Although both methods demonstrate high specificity and reproducibility when executed under a standardized and validated testing protocol, they do present some limitations, including lengthy protocols and issues related to subjectivity, reproducibility, and accuracy. Most laboratories initially use IHC to assess HER2 status, rating the findings as follows: 0 for negative, 1+ for weak, 2+ for equivocal, and 3+ for positive. However, accurately determining HER2 protein expression status using IHC can be significantly influenced by various factors,[54] including the duration of warm/cold ischemia during surgical removal of malignant tissue,[55] delays and durations of fixation, and the type of fixative employed,[56] as well as the method of antigen retrieval.[56] Furthermore, different commercially available antibodies exhibit varying specificity and sensitivity, leading to discrepancies in HER2 overexpression rates depending on the antibody used.[57] It is also critical to note that IHC analysis is particularly vulnerable to inter-observer variability, especially for borderline/ equivocal cases scoring 2+. In addition, discrepancies may occur between HER2 gene amplification and HER2 protein expression due to chromosome 17 polysomy. Other factors contributing to variability in the IHC test include limited specificity and sensitivity of the primary antibody utilized, the application of aggressive antigen retrieval methods, and difficulties associated with tissue fixation and processing.[58] In contrast, FISH is an in situ hybridization test that typically employs specific probes for both the HER2 gene and CEP17 as reference controls. According to ASCO/CAP guidelines, a HER2/CEP17 ratio of <1.8 is considered negative, 1.8–2.0 is deemed equivocal, and >2.0 is classified as positive for HER2 amplification.[43] FISH is more labor-intensive, time-consuming, and costly. Moreover, several studies[59-62] have indicated that genuine polysomy of chromosome 17 is rare. Patients with elevated HER2 counts and concurrently elevated CEP17 copy numbers may be misclassified as non-amplified HER2. Furthermore, BC patients exhibiting an IHC score of 1+ or 2+ alongside a negative FISH assay result are categorized as having low HER2 expression (accounting for 50% of BCs) and require a specific treatment regimen.[63,64] Another variation of the ISH test for assessing HER2 gene amplification in cancer cells is called BDISH. HER2 and CEP17 signals can be simultaneously detected on the same FFPE-BC tissue sample through our fully automated bright-field ISH test. This technique uses fast red to image CEP17 copies while detecting HER2 gene copies through the deposition of metallic silver particles at the reaction site. However, many standard pathology laboratories do not possess the costly automated slide stainer required for this.[65] BDISH provides advantages over FISH brightfield results without needing specialized equipment, allowing simultaneous detection of multiple targets, compatibility with routine staining, stable signals, ease of interpretation, and applicability to various sample types, including formalin-fixed tissues.[37,38,42,66] The choice between BDISH and FISH depends on the requirements of the study and the preferences.[64,67,68]

Current approaches for HER2 testing in routine diagnostics use IHC tests and ISH tests. However, these methods remain subjective, costly, time-consuming, and labor-intensive. Their results may vary in different laboratories and clinics due to different sample conditions or experimental optimizations and processes.[69]

As a result, consistent classification of HER2 status using IHC or ISH assays remains a challenge, particularly for borderline samples. In response to the need for alternative diagnostic assays to enhance the accuracy, affordability, availability, and reliability of clinical HER2 determination, scientists have explored molecular-level assessments for detecting HER2 status using DNA or RNA, as these methods offer significant advantages compared to FISH.[70] In this context, PCR-based techniques have the potential to provide cost-effective and highly accurate quantitative methods for HER2 testing. ddPCR is an emerging technology that employs primer/probe assays or pre-validated primers to amplify a target DNA fragment from a complex sample using Taq polymerase in a quantitative PCR reaction.[71] This highly reliable and reproducible technology relies on the subdivision of the analytical sample into multiple partitions (compartmentalization) that are amplified individually, showing promising applications across several life sciences areas.[72,73] In terms of technology and utility, both the ddPCR and FISH/BDISH methods measure DNA CNV. However, the ddPCR assay is not yet standardized and, therefore, has not been adopted in most laboratories for assessing HER2 gene status in BC samples, particularly in the MENA region.

Therefore, this study investigated the efficacy of ddPCR in comparison to the two conventional and ASCO/CAP approved methods, IHC and BDISH using patients samples from Saudi Arabia. For this purpose, we analyzed HER2 levels using the three methods IHC, BDISH, and ddPCR. All 36 samples were analyzed by IHC, BDISH, and ddPCR to compare the results and to evaluate the sensitivity, specificity, and the accuracy of ddPCR as a new technique to determine HER2/neu status in BC patients and to assess its agreement with the conventional IHC and BDISH methods.

Our results showed significant correlations between the results obtained with ddPCR, BDISH, and IHC. These correlations indicate robust and consistent relationships between the results of these different diagnostic methods. The observed coherence of the results of the three technologies ddPCR, BDISH, and IHC underlines the reliability and mutual support of these techniques in the assessment of HER2 status [Tables 2-5]. This consistency of results reinforces our confidence in the accuracy and effectiveness of ddPCR and provides valuable insight into its utility in HER2 testing. In this context, our results demonstrate that ddPCR is a reliable and cost-effective method for determining HER2 gene status in BC. Despite the reduced sample size, these results showed high concordance rates of 81% with IHC and 83% with BDISH [Table 3]. The sensitivity and specificity of ddPCR compared to IHC were 69% and 90%, respectively. In addition, ddPCR is a more cost-effective and less laborious alternative to BDISH. While these results are promising and align with some previous findings,[74] especially if we consider that this is-to the best of our knowledge – the first study to implement this technology in the GCC region, further standardization and validation of ddPCR on a larger sample size and in multi-laboratories is recommended before routine clinical application. Overall, ddPCR holds the potential for accurate determination of HER2 gene status determination and offers advantages in both accuracy and cost-efficiency.

Regarding the clinical significance of the accurate determination of HER2 status using ddPCR and showing its high concordance of ddPCR with IHC and BDISH, this study demonstrate the ddPCR potential to reduce patients’ misclassification to ensures that only HER2+ patients are correctly chosen for targeted therapy, while HER2-negative patients will avoid unnecessary treatment and related toxicities. Importantly, the ddPCR technology once validated and approved would especially be useful in discriminating equivocal or borderline cases, a known limitation of traditional HER2 testing methods.

One of the critical issues in analyzing ddPCR data is the establishment of appropriate/precise cut-off limits to distinguish between negative and positive samples. The most common and successfully established a cutoff value to distinguish between negative and positive samples was suggested by Shah et al.,[74] In fact, the threshold for a positive sample was set at a ratio of 2.0. Samples with a ratio of <1.8 were considered negative, while samples with a ratio between 1.8 and 2.0 were considered equivocal. Interestingly, they showed that all IHC negative and positive samples agreed with the ddPCR (100% concordance). Furthermore, the proportion of equivocal samples found by IHC (40/84 = 47% of the samples) was reduced to 4% (3/84 = 4%) after ddPCR was used as a second validation technique alongside IHC. Likewise, every sample that tested positive for ddPCR also tested positive for FISH, and every sample that tested negative for ddPCR also tested negative for FISH. The three ddPCR-equivocal IHC-equivocal samples were also FISH-equivocal.[74] In agreement with these results, another cohort of 30 metastatic BC samples (they sample size is smaller than our current cohort) was found to have 100% concordance between IHC, FISH, and BDISH,[75] which is consistent with our current findings.

In this study, we demonstrated that ddPCR is a useful method to assess HER2 amplification status in FFPE samples of BC. We calculated the concordance rate between ddPCR and IHC using 36 BC samples. The concordance rate between HER2 amplification by ddPCR and overexpression of HER2 protein by IHC was 81% in BC samples. These results are consistent with recent studies that reported a high concordance of ddPCR with both IHC and FISH with 91% sensitivity and 100% specificity in breast and gastric carcinoma.[46] Our results are consistent with the findings of this study by Zhu et al.,[46] and show higher accuracy and reliability of ddPCR especially in HER borderline patients, emphasizing that ddPCR is a viable test for this specific category warranting suitable validation of the technique.

In another study using the same cutoff value as in our study (cutoff = 1.8), assessment of HER2 status by ddPCR showed a concordance rate of 94% and 100% with IHC in breast and gastric cancer, respectively, and 86% with the FISH technique.[45] Other studies reported higher concordance rates of ddPCR with IHC/FISH (92%), suggesting that it is also suitable for the assessment of HER2 status in fresh, FFPE and circulating tumor DNA samples.[76]

Taken together, these results show a high concordance of ddPCR with IHC and FISH. These findings support ddPCR as an accurate, cost-effective, technically simpler, and less laborious approach [Table 6] that may be considered as an alternative test to further validate ASCO/CAP-approved IHC/FISH techniques. However, our results and the ddPCR assay in general needs further validation to refine and standardize cutoff values between laboratories in different clinical settings. Once validated and FDA-approved, the ddPCR assay would provide several advantages over current methods (FISH, BDISH): It is automated, quantitative, accurate, reliable, less labor-intensive, easier to interpret, and not subject to inter-observer variability and therefore can be standardized, and performed with a low sample volume.[77,78]

It is important to highlight that the sensitivity, specificity, and concordance rates reported in this study for ddPCR in comparison with BDISH and IHC should be interpreted cautiously, as the small sample size of our cohort may not provide enough robustness of statistical analyses. Therefore, future clinical studies using larger, multi-center, and age-stratified group’s cohorts are needed to validate these results, refine cutoff thresholds, and pave the way toward establishing ddPCR as a standard diagnostic tool in daily clinical practice.

CONCLUSION

The results of this study show that the ddPCR test is a viable option for determining HER2 amplification status in BC patients. Importantly, these results emphasize the high concordance between ddPCR and both BDISH and IHC in the evaluation of HER2 status in Saudi female BC patients. These results suggest that ddPCR, as a rapid, reliable, less technically complex, and cost-effective method, could be an alternative for the detection of HER2 gene status in BC patients, as it has higher sensitivity and specificity comparable to the FISH assay, and could therefore be combined with IHC to effectively and comprehensively assess HER2 status in BC patients once approved by ASCO/CAP authorities.

Limitations

However, for ddPCR technology to become a standard method, further research and standardization studies with a larger sample size and age-stratified cohorts are required before its routine clinical application can be considered. This will ensure a more comprehensive understanding of the assay’s performance, confirm its reliability, and optimize its procedure in the clinical setting.

Consent for publication

Not Applicable. No human participants were prospectively recruited for this study, and suitable informed consent to participate in research was obtained from all of them at the time of admission in accordance with institutional and ethical guidelines.

Animal and human rights statement

All procedures performed in this study were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki Declaration and its later amendments or comparable ethical standards.

Funding statement

The Deanship of Scientific Research (DSR) at King Abdulaziz University, Jeddah, supported and funded this project with grant no. G-542-247-38.

Scientific responsibility statement

The authors declare that they are responsible for the article’s scientific content including study design, data collection, analysis and interpretation, writing, some of the main line, or all of the preparation and scientific review of the contents and approval of the final version of the article.

Acknowledgment:

This Project was funded by the Deanship of Scientific Research (DSR) at King Abdulaziz University, Jeddah, under grant no. G-542-247-38. The authors, therefore, acknowledge with thanks DSR for technical and financial support.

Authors’ contributions:

Study design and conceptualization: MA, AB, and MHA; Methodology: MHA, MA, and AB; Validation: MHA, MAJ, AB; Data collection and analysis: MA, and AB; Writing-original draft preparation: MHA, MA, and MAJ; Writing-review and editing: MA and AB; Project administration and funding: MHA. All authors have read, agreed, and approved of the final submitted version of the manuscript.

Ethical approval:

The research/study approved by the Institutional Review Board at King Bdulaziz University, number 146-25, dated April 10, 2025.

Declaration of patient consent:

Patient’s consent is not required as patients identity is not disclosed or compromised.

Conflicts of interest:

There are no conflicts of interest.

Availability of data and material:

The anonymized datasets analyzed during the present study are available from the corresponding author on reasonable request.

Financial support and sponsorship: Nil.

References

  1. , . A genetic model for colorectal tumorigenesis. Cell. 1990;61:759-67.
    [CrossRef] [PubMed] [Google Scholar]
  2. , . Oncogenes and tumor suppressor genes. Cold Spring Harbor Perspect Biol. 2010;2:a003236.
    [CrossRef] [PubMed] [Google Scholar]
  3. , , , . Integrated transcriptome interactome study of oncogenes and tumor suppressor genes in breast cancer. Genes Dis. 2019;6:78-87.
    [CrossRef] [PubMed] [Google Scholar]
  4. , , , , , , et al. Global patterns of breast cancer incidence and mortality: A population-based cancer registry data analysis from 2000 to 2020. Cancer Commun (Lond). 2021;41:1183-94.
    [CrossRef] [PubMed] [Google Scholar]
  5. , , , . Cancer statistics 2021. CA Cancer J Clin. 2021;71:7-33.
    [CrossRef] [PubMed] [Google Scholar]
  6. , , , , , , et al. Breast cancer statistics, 2022. CA Cancer J Clin. 2022;72:524-41.
    [CrossRef] [PubMed] [Google Scholar]
  7. , , , , , , et al. Epidemiology of cancer in Saudi Arabia thru 2010-2019: A systematic review with constrained meta-analysis. AIMS Public Health. 2020;7:679-96.
    [CrossRef] [PubMed] [Google Scholar]
  8. , , , , , , et al. Population fact sheets. . Global cancer observatory: Cancer today. Lyon, France: International Agency for Research on Cancer; Available from: https://gco.iarc.fr/today/fact-sheets-populations.2022 [Last accessed on 2025 May 23]
    [Google Scholar]
  9. , , , . Proportion of U.S. trends in breast cancer incidence attributable to long-term changes in risk factor distributions. Cancer Epidemiol Biomarkers Prev. 2018;27:1214-22.
    [CrossRef] [PubMed] [Google Scholar]
  10. , . Incidence trends of breast cancer in Saudi Arabia: A joinpoint regression analysis (2004-2016) J King Saud Univ Sci. 2021;33:101578.
    [CrossRef] [Google Scholar]
  11. , , , , , , et al. Cancer incidence trends from 1999 to 2015 and contributions of various cancer types to the overall burden: Projections To 2030 and extrapolation of economic burden in Saudi Arabia. Cancer Manag Res. 2019;11:9665-74.
    [CrossRef] [PubMed] [Google Scholar]
  12. , , , , . Breast cancer epidemiology in gulf cooperation council countries: A regional and international comparison. Clin Breast Cancer. 2018;18:e381-92.
    [CrossRef] [PubMed] [Google Scholar]
  13. . Breast cancer incidence patterns in the Saudi female population: A 17-year retrospective analysis. Medicina (Kaunas). 2022;58:1617.
    [CrossRef] [PubMed] [Google Scholar]
  14. , , , , , . Endocrine therapy of breast cancer. Curr Med Chem. 2011;18:513-22.
    [CrossRef] [PubMed] [Google Scholar]
  15. , , , , . A review on the effects of current chemotherapy drugs and natural agents in treating non-small cell lung cancer. Biomedicine (Taipei). 2017;7:23.
    [CrossRef] [PubMed] [Google Scholar]
  16. , , . Insights into molecular classifications of triple-negative breast cancer: Improving patient selection for treatment. Cancer Discov. 2019;9:176-98.
    [CrossRef] [PubMed] [Google Scholar]
  17. , , , . Cancer hallmarks, biomarkers and breast cancer molecular subtypes. J Cancer. 2016;7:1281-94.
    [CrossRef] [PubMed] [Google Scholar]
  18. , , , , , . Strategies for subtypes--dealing with the diversity of breast cancer: Highlights of the St. Gallen international expert consensus on the primary therapy of early breast cancer 2011. Ann Oncol. 2011;22:1736-47.
    [CrossRef] [PubMed] [Google Scholar]
  19. , , , , , , et al. Estrogen and progesterone receptor testing in breast cancer: ASCO/CAP guideline update. J Clin Oncol. 2020;38:1346-66.
    [CrossRef] [PubMed] [Google Scholar]
  20. , , , , , , et al. Progesterone receptor expression is an independent prognostic variable in early breast cancer: A population-based study. Br J Cancer. 2014;110:565-72.
    [CrossRef] [PubMed] [Google Scholar]
  21. , , . Predictive biomarkers for checkpoint immunotherapy: Current status and challenges for clinical application. Cancer Immunol Res. 2018;6:1122.
    [CrossRef] [PubMed] [Google Scholar]
  22. , , , , , , et al. Long-term clinical outcomes and biomarker analyses of atezolizumab therapy for patients with metastatic triple-negative breast cancer: A phase 1 study. JAMA Oncol. 2019;5:74-82.
    [CrossRef] [PubMed] [Google Scholar]
  23. , , . The neu oncogene encodes an epidermal growth factor receptor-related protein. Nature. 1986;319:226-30.
    [CrossRef] [PubMed] [Google Scholar]
  24. , , , , , , et al. Tyrosine kinase receptor with extensive homology to EGF receptor shares chromosomal location with neu oncogene. Science. 1985;230:1132-9.
    [CrossRef] [PubMed] [Google Scholar]
  25. , , . Targeting HER2-positive breast cancer: Advances and future directions. Nat Rev Drug Discov. 2022;22:101-26.
    [CrossRef] [PubMed] [Google Scholar]
  26. , , , , , , et al. Studies of the HER-2/neu proto-oncogene in human breast and ovarian cancer. Science. 1989;244:707-12.
    [CrossRef] [PubMed] [Google Scholar]
  27. , . The HER-2/neu oncogene in breast cancer: Prognostic factor, predictive factor, and target for therapy. Stem Cells. 1998;16:413-28.
    [CrossRef] [PubMed] [Google Scholar]
  28. , , , , , , et al. Clinical significance and prognostic value of serum sHER-2/neu levels in patients with solid tumors. Med Oncol. 2009;26:151-6.
    [CrossRef] [PubMed] [Google Scholar]
  29. , , , , . Assessment of HER2 status in breast cancer: Overall positivity rate and accuracy by fluorescence in situ hybridization and immunohistochemistry in a single institution over 12 years: A quality control study. BMC Cancer. 2013;13:615.
    [CrossRef] [PubMed] [Google Scholar]
  30. , , , , , , et al. Immunohistochemistry and alternative FISH testing in breast cancer with HER2 equivocal amplification. Breast Cancer Res Treat. 2018;170:321-8.
    [CrossRef] [PubMed] [Google Scholar]
  31. , , , , , , et al. Pathological identification of HER2-low breast cancer: Tips, tricks, and troubleshooting for the optimal test. Front Mol Biosci. 2023;10:1176309.
    [CrossRef] [PubMed] [Google Scholar]
  32. , , , , , , et al. Multiplex droplet digital PCR assay for detection of MET and HER2 genes amplification in non-small cell lung cancer. Cancers (Basel). 2022;14:1458.
    [CrossRef] [PubMed] [Google Scholar]
  33. , , , , , . Reproducibility in the automated quantitative assessment of HER2/neu for breast cancer. J Pathol Inform. 2013;4:19.
    [CrossRef] [PubMed] [Google Scholar]
  34. , , , , , , et al. Silver in situ hybridization (SISH) for determination of HER2 gene status in breast carcinoma: Comparison with FISH and assessment of interobserver reproducibility. Am J Surg Pathol. 2010;34:767-76.
    [CrossRef] [PubMed] [Google Scholar]
  35. , , , , , , et al. Chromogenic in situ hybridization for Her-2/neu-oncogene in breast cancer: Comparison of a new dual-colour chromogenic in situ hybridization with immunohistochemistry and fluorescence in situ hybridization. Histopathology. 2009;55:716-23.
    [CrossRef] [PubMed] [Google Scholar]
  36. , , , , , , et al. Development of automated brightfield double in situ hybridization (BDISH) application for HER2 gene and chromosome 17 centromere (CEN 17) for breast carcinomas and an assay performance comparison to manual dual color HER2 fluorescence in situ hybridization (FISH) Diagn Pathol. 2008;3:41.
    [CrossRef] [PubMed] [Google Scholar]
  37. , , , , , , et al. The assessment of HER2 status in breast cancer: The past, the present, and the future. Pathol Int. 2016;66:313-24.
    [CrossRef] [PubMed] [Google Scholar]
  38. , , , , . Droplet-based digital PCR (ddPCR) and its applications. TrAC Trends Analyt Chem. 2023;158:116897.
    [CrossRef] [Google Scholar]
  39. , , , . Chapter three - droplet-based digital PCR: Application in Cancer Research In: , ed. Advances in Clinical Chemistry. Vol 79. Amsterdam: Elsevier; . p. :43-91.
    [CrossRef] [Google Scholar]
  40. , , , , , , et al. Developing centrifugal force real-time digital PCR for detecting extremely low DNA concentration. Sci Rep. 2024;14:11522.
    [CrossRef] [PubMed] [Google Scholar]
  41. , , . The clinical utility of droplet digital PCR for profiling circulating tumor DNA in breast cancer patients. Diagnostics (Basel). 2022;12:3042.
    [CrossRef] [PubMed] [Google Scholar]
  42. , , , , , , et al. Prognostic value of HER2 status in bladder transitional cell carcinoma revealed by both IHC and BDISH techniques. BMC Cancer. 2016;16:653.
    [CrossRef] [PubMed] [Google Scholar]
  43. , , , , , , et al. Recommendations for human epidermal growth factor receptor 2 testing in breast cancer: American society of clinical oncology/College of American pathologists clinical practice guideline update. J Clin Oncol. 2013;31:3997-4013.
    [CrossRef] [PubMed] [Google Scholar]
  44. , , , . Evaluation of droplet digital PCR for characterizing plasmid reference material used for quantifying ammonia oxidizers and denitrifiers. Anal Bioanal Chem. 2014;406:1701-12.
    [CrossRef] [PubMed] [Google Scholar]
  45. , , , , , . Human epidermal growth factor receptor 2 amplification detection by droplet digital polymerase chain reaction in formalin-fixed paraffin-embedded breast and gastric cancer samples. J Cancer Res Ther. 2017;13:730-34.
    [CrossRef] [PubMed] [Google Scholar]
  46. , , , , , , et al. Droplet digital polymerase chain reaction detection of HER2 amplification in formalin fixed paraffin embedded breast and gastric carcinoma samples. Exp Mol Pathol. 2016;100:287-93.
    [CrossRef] [PubMed] [Google Scholar]
  47. , , . Predictive factors of breast cancer evaluated by immunohistochemistry. J Bras Patol Med Lab. 2008;44:131-40.
    [CrossRef] [Google Scholar]
  48. , , . Predictive markers of breast cancer: ER, PR, and HER2 In: , , eds. Handbook of Practical Immunohistochemistry: Frequently Asked Questions. New York: Springer; . p. :103-17.
    [CrossRef] [Google Scholar]
  49. , . Testing for HER2 in breast cancer: A continuing evolution. Pathol Res Int. 2011;2011:903202.
    [CrossRef] [PubMed] [Google Scholar]
  50. , , , , , , et al. Human epidermal growth factor receptor 2 testing in breast cancer: ASCO-college of American pathologists guideline update. J Clin Oncol. 2023;41:3867-72.
    [CrossRef] [PubMed] [Google Scholar]
  51. , , , , , , et al. American Society of Clinical Oncology/College of American Pathologists guideline recommendations for human epidermal growth factor receptor 2 testing in breast cancer. Arch Pathol Lab Med. 2007;131:18-43.
    [CrossRef] [PubMed] [Google Scholar]
  52. , , , , . Comparing the 2017 ASCO/CAP guideline for gastroesophageal adenocarcinoma surgical specimen to the 2018 ASCO/CAP guideline for breast cancer in assessing the HER2 status in primary mucinous ovarian carcinoma. Virchows Archiv. 2022;480:1023-30.
    [CrossRef] [PubMed] [Google Scholar]
  53. , , , , , , et al. HER2 testing and clinical decision making in gastroesophageal adenocarcinoma: Guideline from the college of American pathologists, American society for clinical pathology, and the american society of clinical oncology. J Clin Oncol. 2017;35:446-64.
    [CrossRef] [PubMed] [Google Scholar]
  54. , , , . Concordance in judgments among c-erbB-2 (HER2/neu) overexpression detected by two immunohistochemical tests and gene amplification detected by Southern blot hybridization in breast carcinoma. Pathol Int. 2001;51:26-32.
    [CrossRef] [PubMed] [Google Scholar]
  55. , , . The effect of cold ischemic time on the immunohistochemical evaluation of estrogen receptor, progesterone receptor, and HER2 expression in invasive breast carcinoma. Mod Pathol. 2012;25:1098-105.
    [CrossRef] [PubMed] [Google Scholar]
  56. , , , , , , et al. Implementation of American society of clinical oncology/college of American pathologists HER2 guideline recommendations in a tertiary care facility increases HER2 immunohistochemistry and fluorescence in situ hybridization concordance and decreases the number of inconclusive cases. Arch Pathol Lab Med. 2009;133:775-80.
    [CrossRef] [PubMed] [Google Scholar]
  57. , , , , , , et al. Her-2/neu analysis in archival tissue samples of human breast cancer: Comparison of immunohistochemistry and fluorescence in situ hybridization. J Clin Oncol. 2001;19:354-63.
    [CrossRef] [PubMed] [Google Scholar]
  58. , , , , , , et al. Cell blocks in cytology: Review of preparation methods, advantages, and limitations. J Am Soc Cytopathol. 2023;12:77-88.
    [CrossRef] [PubMed] [Google Scholar]
  59. , , , , , , et al. Clinical validation of an array CGH test for HER2 status in breast cancer reveals that polysomy 17 is a rare event. Mod Pathol. 2009;22:1169-75.
    [CrossRef] [PubMed] [Google Scholar]
  60. , , , , , , et al. Does chromosome 17 centromere copy number predict polysomy in breast cancer? A fluorescence in situ hybridization and microarray-based CGH analysis. J Pathol. 2009;219:16-24.
    [CrossRef] [PubMed] [Google Scholar]
  61. , , , , , , et al. Determining true HER2 gene status in breast cancers with polysomy by using alternative chromosome 17 reference genes: Implications for anti-HER2 targeted therapy. J Clin Oncol. 2011;29:4168-74.
    [CrossRef] [PubMed] [Google Scholar]
  62. , , , , , . Assessment of HER2 gene status in breast carcinomas with polysomy of chromosome 17. Cancer. 2011;117:48-53.
    [CrossRef] [PubMed] [Google Scholar]
  63. , , , , , , et al. Unusual patterns of HER2 expression in breast cancer: Insights and perspectives. Pathobiology. 2022;89:278-96.
    [CrossRef] [PubMed] [Google Scholar]
  64. , , , , , , et al. Human epidermal growth factor receptor 2 testing in breast cancer. Arch Pathol Lab Med. 2023;147:993-1000.
    [CrossRef] [PubMed] [Google Scholar]
  65. , , , , , , et al. Dual-colour chromogenic in-situ hybridization is a potential alternative to fluorescence in-situ hybridization in HER2 testing. Histopathology. 2011;59:984-92.
    [CrossRef] [PubMed] [Google Scholar]
  66. , , , , , , et al. Assessment of ErbB2 (Her2) in oesophageal adenocarcinomas: Summary of a revised immunohistochemical evaluation system, bright field double in situ hybridisation and fluorescence in situ hybridisation. Mod Pathol. 2011;24:908-16.
    [CrossRef] [PubMed] [Google Scholar]
  67. . Recent trends of HER-2 testing and trastuzumab therapy for breast cancer. Breast Cancer. 2009;16:284-7.
    [CrossRef] [Google Scholar]
  68. , , , . HER-2 oncogene amplification assessment in invasive breast cancer by dual-color in situ hybridization (dc-CISH): A comparative study with fluorescent in situ hybridization (FISH) Ann Pathol. 2011;31:472-9.
    [CrossRef] [PubMed] [Google Scholar]
  69. , , , , , . Comparison of immunohistochemical methods (IHC) and fluorescent in situ hybridization (FISH) in the detection of HER 2/neu gene in kurdish patients with breast cancer in Western Iran. Int J Hematol Oncol Stem Cell Res. 2022;16:217-23.
    [CrossRef] [PubMed] [Google Scholar]
  70. , , , , , , et al. Her2 assessment using quantitative reverse transcriptase polymerase chain reaction reliably identifies Her2 overexpression without amplification in breast cancer cases. J Transl Med. 2017;15:91.
    [CrossRef] [PubMed] [Google Scholar]
  71. , , . Droplet digital PCR versus qPCR for gene expression analysis with low abundant targets: From variable nonsense to publication quality data. Sci Rep. 2017;7:2409.
    [CrossRef] [PubMed] [Google Scholar]
  72. , . Quantitation of JAK2 V617F allele burden by using the QuantStudio™ 3D digital PCR system In: , , eds. Digital PCR: Methods and Protocols. New York: Springer; . p. :257-73.
    [CrossRef] [PubMed] [Google Scholar]
  73. , . Digital PCR. In: Methods in Molecular Biology. Germany: Springer; .
    [CrossRef] [Google Scholar]
  74. , , , , , , et al. Single-day HER2neu amplification assessment using chip-based digital PCR in formalin-fixed paraffin-embedded breast carcinoma tissue. Breast Cancer (Dove Med Press). 2018;10:121-9.
    [CrossRef] [PubMed] [Google Scholar]
  75. , , , , , . HER2 assessment by bright-field dual in situ hybridization in cell blocks of recurrent and metastatic breast carcinoma. Cancer Cytopathol. 2019;127:684-90.
    [CrossRef] [PubMed] [Google Scholar]
  76. , , , , , , et al. Droplet digital PCR measurement of HER2 in patients with gastric cancer. Br J Cancer. 2015;112:1652-5.
    [CrossRef] [PubMed] [Google Scholar]
  77. , , , , , , et al. A gene-protein assay for human epidermal growth factor receptor 2 (HER2): Brightfield tricolor visualization of HER2 protein, the HER2 gene, and chromosome 17 centromere (CEN17) in formalin-fixed, paraffin-embedded breast cancer tissue sections. Diagn Pathol. 2012;7:60.
    [CrossRef] [PubMed] [Google Scholar]
  78. , , , . HER2 testing: Current status and future directions. Cancer Treat Rev. 2014;40:276-84.
    [CrossRef] [PubMed] [Google Scholar]
Show Sections